Genotyping and Antifungal Susceptibility of C. albicans Isolated from Infected women
Luma T. Ahmed*
Assist. Prof. Medical Mycology, College of Medicine Branch of Microbiology, Diyala University Diyala
*Corresponding Author E-mail: lumataha03@gmail.com
ABSTRACT:
The aim of this study was to determine the genotypic and antifungal susceptibility of C. albicans obtained from vulvaginities women The study included 100 vulvaginitis patients who exhibited candidiases infection in uterus. vaginal swabs from women patients and healthy persons screened for the occurrence of C. albicans. Isolates were identified by the conventional mycological methods. Genotypes were determined using 25S rDNA PCR analysis. Vaginal C. albicans was detected in(39.6) % women patients and For the 21 isolates of C. albicans: 14 (66.7 %), 4 (19 %), and 3 (14.3%) isolates were recognized as genotypes A, B and C, respectively …in vitro susceptibility tests were performed using the agar inhibition zone method recommended by the Clinical and Laboratory Standard, the results showed that all C. albicans genotypes (100)%were sensitive to Miconazole. In the case of Nystatin (95)% of isolates were sensitive and (4.8)% were resistant. For ketoconazole (71.4)% of isolates were sensitive (23.8)%were resistant, and (4.8)%showed dose dependent sensitivity. For Fluconazole antifungal (66.7) % of isolates showed sensitivity to fluconazole, (28.6)% were resistant and (4.7)%were dose dependent.
KEYWORDS: Candida albicans, genotyping, antifungal susceptibility.
INTRODUCTION:
Other non-albicans species were less likely found in clinical samples although many reports described infections caused by these uncommon Candida species6.
Isolation of Candida spp. from vaginal samples showed that they can be presented in 20-50% of healthy women during their reproductive period, but they showed a marked decrease after the menopause age7. C.albicans normally inhabits in the vagina. It coexists with the beneficial bacteria such as Lactobacillus spp. which interfere with the adherence of C.albicans to vaginal epithelial cells8.
Clinical symptoms of vulvovaginal candidiasis include itching, erythema and edema of the vulva, white discharge from the vagina, and pain during sexual intercourse9. Vaginal candidiasis can be diagnosed by routine techniques such as conventional culture, and biochemical tests, but these are time-consuming and may not give accurate results10.
Molecular techniques such as (PCR) are more rapid and have high sensitivity and specificity than conventional techniques11. Detection of C. albicans genotypes is important in epidemiological studies.
In this method C. albicans was classified into five genotypes according to the size of amplified PCR products: genotype A (450) bp, genotype B (840) bp, genotype C (450 and 840) bp, genotype D (1,080) bp, and genotype E (1,400) bp12,13. Studying Candida species and C.albicans genotypes is important for correct treatment because there is a difference in response to same antifungal treatment14,15.
It was founded that there was a significant increase in the incidence of yeast infections in humans16. The increase of infection rate by Candida species and the excessive using of antifungal drugs have led to resistance to these drugs over the past few decades17. Ultimately, this led to increasing in the morbidity and mortality14.
This study aimed to:
Determining of C.albicans genotypes susceptibility to commonly used antifungal drugs.
MATERIALS AND METHODS:
Culturing of collected samples:
Sabouraud dextrose agar (SDA) was used for primary isolation of Candida species. It inhibits bacterial growth because of its low pH. For enhance its selectivity; (0.005 g/L) of chloramphenicol vial was added to the media. Vaginal samples that were collected by cotton swabs were streaked on the plates that contained the prepared media and incubated at 30ºC for 48 hours for isolation pure Candida colonies. After the incubation period, the isolates were examined for their shape, color, size, and consistency. The plates were enclosed by parafilm to prevent contamination. Finally, they were stored in the refrigerator to keep the culture18.
Identification of C.albicans genotypes by PCR:
C.albicans isolates which were identified on CHROM agar media and formed germ tubes; were selected to study their genotypes by PCR method.
Genomic DNA extraction:
Genomic DNAs were extracted from C.albicans isolates according to the instructions of the provided kit, and by using previously described methods by19.
Assessment of DNA concentration and purity:
The concentration of extracted DNA was estimated by using Nano drop; the device which was used for determining the optical density (O.D) of DNA at 260nm and 280nm wave lengths. This device was also used to measure the purity ratio of the extracted DNA according to the formula below:
DNA purity = (O.D 260nm) / (O.D 280nm)
This ratio was used for detecting if DNA was contaminated with protein preparation20.
PCR primers:
In order to identify Candida albicans genotypes on the basis of 25S rDNA, two primers: CA-INT-L (ATAAGGGAAGTCGGCAAAATAGATCCGTAA) and CA-INT-R (CCTTGGCTGTGGTTTCGCTAGATAGTAGAT) were used, and according to PCR products sizes, C. albicans was classified into five genotypes: A, B, C, D, and E12;13.
PCR working solution:
Polymerase Chain Reaction (PCR) working solution which was used for DNA amplification was prepared according to the protocol of the used kit. 25μl of reaction mixture was prepared in each sterile Eppendorf tube as follow: (working solution G2 green master mix PCR (12.5)µl, template DNA (5)µl, forward primer (2.5)µl, revers primer (2.5)µl, grade water (2.5)µl, final volume (25)µl.
Statistical Analysis:
Statistical analysis was conducted by using Statistical Package for Social Sciences (SPSS) 16.01.
Antifungal sensitivity test for C.albicans genotypes:
Antifungal susceptibility test refers to subjecting a specific drug to a fungi isolates and observing its activity. In the current study; the isolates of C.albicans genotypes were tested by the Kirby-Bauer disc diffusion technique on Mueller Hinton agar plates 21.
The antifungal agents that used are: Fluconazole, Ketoconazole, Miconazole and Nystatin in concentration (25, 15, 10, 5) µg/disc respectively (Bioanalyse/Turkey) which are usually used for treatment of VVC. Antifungal discs were placed on Mueller Hinton agar surface by using sterile forceps. The plates were incubated at 35°C for 24 h. The inhibition zone size was interpreted by referring to an interpretative chart table (Table 1.) which is recommended by22 guidelines into sensitive, intermediate and resistant.
Table 1.: Zone-diameter interpretive standers according to 22.
|
Antifungal agent |
Disc content |
Diameter of inhibition zones(mm) |
||
|
Resistant |
Intermediate |
Sensitive |
||
|
Fluconazole |
25 μg |
< 14 |
15 – 18 (DD) |
> 19 |
|
Ketoconazole |
15 μg |
< 20 |
21 – 27(DD) |
> 28 |
|
Miconazole |
10 μg |
<11 |
12 – 19 (DD) |
> 20 |
|
Nystatin |
50 μg |
No zone |
10 – 14 (DD) |
> 15 |
Candida albicans DNAs were extracted by using a Wizard® Genomic DNA Purification Kit protocol. Nano drop apparatus was used in this study to measure the absorbance of DNA solutions, DNA rehydration solution was used as a blank.
RESULTS:
The culture samples of vaginal swabs were firstly isolated from sabouraud dextrose agar media then identified or diagnosed by culturing on chrom agar media, the Candida albicans species were diagnosed as green color. identification of C. albicans genotypes by PCR targeting 25S rDNA, Measurement concentration and purity of the extracted DNA from C.albicans isolates.
Concentrations of C.albicans DNAs were in range of (15.9-60) ng/ml, and the purity (OD260/280 ratio) was in a range (1.7-1.9). So the extracted DNAs were considered pure because they were within the expected range of purity (1.7 -2) according to 23.
Genomic DNAs of all C. albicans isolates were amplified by PCR to detect their genotypes using primer pairs (CA-INT-L and CA-INT-R) by targeting the gene 25S rDNA. Gel electrophoresis profiles defined DNA products as following: 450 bp for C.albicans genotype A, 840 bp for genotype B, and both 450 bp and 840 bp for genotype C (Figure 1: A & B). None of the PCR products in this study were genotype D (1,080 bp) or genotype E (1,400 bp product).
Figure 1. A.: Agarose gel electrophoresis of C. albicans genotypes by PCR targeting 25S rDNA on 2% Agarose gel, 5 volt/cm for 1 hr, stained with ethidium bromide dye. (part- 1). Genomic DNA products of 450 bp for genotype A in lanes: (61,31,44,21,13,1,5). 840 bp for genotype B in lanes: (20, 12). Both 450 bp and 840 bp for genotype C in lanes: (52, 11). M indicates the lane containing 100 bp DNA ladder which is shown on the left and right sides of the panels. NC refers to negative control.
Figure 1. B.: Agarose gel electrophoresis of C. albicans genotypes by PCR targeting 25S rDNA on 2% Agarose gel, 5 volt/cm for 1 hr, stained with ethidium bromide dye (part -2). Genomic DNA products of 450 bp for genotype A in lanes: (7, 14, 36, 41, 72, 84, 92). 840 bp for genotype B in lanes:
(2, 53). Both 450 bp and 840 bp for genotype C in lanes: (57). M indicates the lane containing 100 bp DNA ladder which is shown on the left and right sides of the panels. NC refers to negative control.
For the 21 isolates of C. albicans: 14 (66.7 %), 4 (19 %), and 3 (14.3%) isolates were recognized as genotypes A, B and C, respectively (Table 1.).
Table 2.: Frequency of C.albicans genotypes in VVC patients
|
C. albicans genotypes |
No. |
% |
|
A |
14 |
66.7% |
|
B |
4 |
19% |
|
C |
3 |
`14.3% |
|
Total |
21 |
100% |
These results showed that C.albicans genotype A
occupied the highest rate among all genotypes in a percentage of (66.7%), followed
by genotype B and C in the percentage of (19 %) and (14.3 %), respectively
.
Candida albicans genotypes were distributed in variable patterns in different groups. However, genotype A was the most predominant type; 14 isolates of genotype A (66.7 %) were detected through this study, its high rate of distribution was in contraception users group (38.1%), while it was (33.3%) in patients group with vulval pruritus symptom.
Genotype B followed genotype A in its frequency; its high rate of distribution was in contraception users (19.1 %). and it was distributed equally in (vulval pruritus & vaginal erythema groups) in a percentage of 9.5%.
Genotype C was found with a high rate in contraception users (14.3%), followed by patients with vulval erythema and discharge (9. 5%).
Sensitivity of C.albicans genotypes to antifungal drugs:
Figure (1) shows the results of C.albicans genotypes sensitivity for the antifungal drugs (Fluconazole, Ketoconazole, Miconazole, and Nystatin) by disc diffusion method. The results of this test were interpreted according to22.
Figure 2: Susceptibility of C.albicans genotypes to antifungal drugs.
It was showed that all C.albicans isolates (100 %) were sensitive to Miconazole; in which the diameter of growth inhibition zone (> 20 mm), there was no resistant to this drug. For Nystatin; 95.2 % of C.albicans isolates were sensitive to it (growth inhibition zone diameters were > 15mm), while only 4.8 % were resistant (there was no inhibition zone on the medium).
In the case of ketoconazole agent; 71.4% of isolates were sensitive (growth inhibition zone diameters were > 28 mm), while 4.8% of isolates showed dose dependent sensitivity (growth inhibition zone diameters were 21 – 27mm), and 23.8% were resistant (growth inhibition zone diameters were < 20mm).
Finally, for Fluconazole drug; 66.6% of isolates were sensitive (growth inhibition zone diameters were > 19mm), while 4.8% were dose dependent (growth inhibition zone diameters were 15 – 18mm), and 28.6% were resistant to this drug (growth inhibition zone diameters were< 14mm), (Table 2.).
Table 3.: Antifungal susceptibility test of C. albicans genotypes by disc diffusion method
|
Nystatine |
Miconazole |
Ketoconazole |
Fluconazole |
Results on MH media |
Total No. |
C. albicans |
||||||
|
% |
No. of isolates |
% |
No. of isolates |
% |
No. of isolates |
% |
No. of isolates |
|
|
|
||
|
92.9 |
13 |
100 |
14 |
71.4 |
10 |
64 |
9 |
S |
14 |
Genotype A |
||
|
0 |
0 |
0 |
0 |
7.1 |
1 |
7.1 |
1 |
I |
||||
|
1.7 |
1 |
0 |
0 |
21.1 |
3 |
28.6 |
4 |
R |
||||
|
100 |
14 |
100 |
14 |
100 |
14 |
100 |
14 |
Total no. &% |
||||
|
p-value=0.2 |
|
|
||||||||||
|
100 |
4 |
100 |
4 |
75 |
3 |
75 |
3 |
S |
4 |
Genotype B |
||
|
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
I |
||||
|
0 |
0 |
0 |
0 |
25 |
1 |
25 |
1 |
R |
||||
|
100 |
4 |
100 |
4 |
100 |
4 |
100 |
4 |
Total no. &% |
||||
|
p-value=0.51 |
|
|
||||||||||
|
100 |
3 |
100 |
3 |
66.7 |
2 |
66.7 |
2 |
S |
3 |
Genotype C
|
||
|
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
I |
||||
|
0 |
0 |
0 |
0 |
33.3 |
1 |
33.3 |
1 |
R |
||||
|
3 |
3 |
3 |
3 |
100 |
3 |
100 |
3 |
Total no. &% |
||||
|
p-value =0.49 |
21 |
Total no. |
||||||||||
S= Sensitive I=Intermediate R= Resistant
There was no significant association between C.albicans genotypes and antifungal drugs (P>0.05)
For the 14 isolates of C.albicans genotype A; 64.3% of isolates were sensitive to Fluconazole, while 7.1% and 28.6% of isolates were intermediate and resistant to Fluconazole, respectively. In the case of Ketoconazole; 71.4% of isolates were sensitive, 7.1% of isolates were intermediate, and 21.5% were resistant to Ketoconazole. For Nystatin agent; 92.9% of isolates were sensitive, and only 7.1% of isolates were resistant. Finally, all genotype A isolates were sensitive to Miconazole drug in percentage of 100%, and there was no resistant to this drug (Figure 2.).
For C.albicans genotype B; 75% of isolates were sensitive to Fluconazole, while 25% were resistant. In the case of Ketoconazole; also 75% of isolates were sensitive, and 25 % of isolates were resistant to Ketoconazole. While for both Miconazole and Nystatin; the sensitivity was 100 %, and there was no resistant to both drugs (Figure 3.).
Figure 3.: Susceptibility of C.albicans genotype A to antifungal drugs:
1- Resistance of isolates to Ketoconazole (Growth inhibition zone diameter <20mm).
2- Resistance of isolates to Nystatin ( No inhibition zone on the medium).
3- Sensitivity of isolates to Fluconazole (Growth inhibition zone diameter > 19mm).
4- Sensitivity of isolates to Miconazole ( Growth inhibition zone diameter > 20mm).
Figure 4.: Susceptibility of C.albicans genotype B to antifungals.
1- Sensitivity of isolates to Nystatin (Growth inhibition zone diameter > 15 mm).
2- Resistance of isolates to Fluconzole (Growth inhibition zone diameter <14mm).
3- Sensitivity of isolates to Miconazole (Growth inhibition zone diameter > 20 mm).
4- Resistance of isolates to Ketoconazole (Growth inhibition zone diameter <20mm).
Genotype C isolates showed sensitivity for both Fluconazole and Ketoconazole drugs in a percentage of 66.7 %, and resistance in a percentage of 33.3 %. In the case of Miconazole and Nystatin; the sensitivity of the isolates was 100 %, and there was no resistant to the both drugs (Figure 4.).
Figure 5.: Susceptibility of C.albicans genotype C to antifungals.
1- Sensitivity of isolates of Nystatin (Growth inhibition zone diameter >15mm).
2- Resistance of isolates of Fluconazole( Growth inhibition zone diameter <14mm).
3- Sensitivity of isolates of Miconazole (Growth inhibition zone diameter>20 mm).
4- Resistance of isolates of Ketoconazole (Growth inhibition zone diameter <20mm).
DISCUSSION:
The antifungal drugs sensitivity test against C.albicans genotypes showed that all C.albicans isolates (100 %) were sensitive to miconazole, and there was no resistant to this drug. For nystatin 95.2 % of C.albicans isolates were sensitive, while only 4.8 % were resistant. In the case of ketoconazole agent; 71.4% of isolates were sensitive, while 4.8% of isolates showed dose dependent sensitivity, and 23.8% were resistant. Finally, for fluconazole drug; 66.6% of isolates were sensitive, while 4.8% were dose dependent, and 28.6% were resistant to this drug (Figure 2).
The isolates of C.albicans genotype A showed sensitivity in percentage of 100% to miconazole, while its sensitivity to nystatin, ketoconazole and fluconazole was 92.9%,71.4% and 64.3%, respectively. Genotype B showed sensitivity in percentage of 100% to both nystatin and miconazole, while they showed the same rate of sensitivity (75%) and resistance (25%) for both ketoconazole and fluconazole drugs. Genotype C also showed the same sensitivity rate (100%) to both nystatin and miconazole drugs, and showed sensitivity rate (66.7%) and resistance rate (33.3%) for both ketoconazole and fluconazole drugs.as demonstrated in figure (3,4,5) respectively.
There was no significant association between C.albicans genotypes and antifungal drugs (P>0.05). So these results agreed with those of23 who found no significant association between C.albicans genotypes and antifungal drugs.
In this study; the resistance of C.albicans genotypes (A, B and C) to fluconazole agreed with23 in Iraq; who found that 15.2% of genotype A isolates were resistant to fluconazole, and 25 % of both genotype B and C were resistant to this drug.
Some of the studies reported that reduced C.albicans susceptibilities to fluconazole appeared after over usage of it as a treatment for some conditions; especially when it was prescribed to the immunocompromised patients as a standard care, thus this was the leading cause of resistance24 and25. The resistance of the isolates for ketoconazole agreed with23 who found that the resistance of genotype A, B, and C were (18.2%, 25%, and 25%) respectively. It also agreed with the results of study by26 and24, but it disagreed with27 who found that there was no resistance to ketoconazole in isolates collected from turkeys in Iraq.
The results of genotypes sensitivity in a percentage of 100% for miconazole in the current study agreed with28 and29 who didn’t find a resistance of C.albicans isolates to miconazole in Iraq. Finally, the high sensitivity of the isolates to nystatin agreed with the results obtained by30,28 who found a high sensitivity of these isolates to nystatin drug.
REFERENCES:
1. Kumamoto CA, Pierce JV. Immunosensing during colonization by Candida albicans: does it take a village to colonize the intestine?. Trends in microbiology. 2011 Jun 1;19(6):263-7.
2. Brenda, B.; James, A. and Benjamin, D. K. Neonatal Candidiasis. Journal of Paediatrics, 2014. 79: 123- 125.
3. Ruhnke M, Paiva J, Grigos I, Miller P, Marcek T, Kantechi M. Anidulation for candidaemia in non-neutropenic intensive care unit patients. Journal of Critical Care. 2011; 15:240.
4. Udayalaxmi SJ, D’Souza D. Comparison between virulence factors of Candida albicans and non-albicans species of Candida isolated from genitourinary tract. Journal of clinical and diagnostic research: JCDR. 2014 Nov;8(11):DC15.
5. Williams DW, Kuriyama T, Silva S, Malic S, Lewis MA. Candida biofilms and oral candidosis: treatment and prevention. Periodontology 2000. 2011 Feb;55(1):250-65.
6. Brandt ME, Lockhart SR. Recent taxonomic developments with Candida and other opportunistic yeasts. Current fungal infection reports. 2012 Sep 1;6(3):170-7.170-177.
7. Ferreira C, Silva S, Faria-Oliveira F, Pinho E, Henriques M, Lucas C. Candida albicans virulence and drug-resistance requires the O-acyltransferase Gup1p. BMC microbiology. 2010 Dec;10(1):238.
8. Gregory T. The quandary of recurrent vaginal candidiasis. Patient Care. 2000 Jan 30;34(2):123-.
9. Paulitsch A, Weger W, Ginter‐Hanselmayer G, Marth E, Buzina W. A 5‐year (2000–2004) epidemiological survey of Candida and non‐Candida yeast species causing vulvovaginal candidiasis in Graz, Austria. Mycoses. 2006 Nov;49(6):471-5.
10. Hospenthal, D.R.; Beckius, M.L.; Floyd, K.L.; Horvath, L.L. and Murray,C.K.. Presumptive identification of Candida species other than C. albicans, C. krusei and C. tropicalis with chromoagar medium Chromoagar candida. Ann. Clin. Microbiol. Antimicrob. 2006.5:1-5
11. Goswami D, Goswami R, Banerjee U, Dadhwal V, Miglani S, Lattif AA, Kochupillai N. Pattern of Candida species isolated from patients with diabetes mellitus and vulvovaginal candidiasis and their response to single dose oral fluconazole therapy. Journal of Infection. 2006 Feb 1;52(2):111-7.
12. Tamura M, Watanabe K, Mikami Y, Yazawa K, Nishimura K. Molecular Characterization of New Clinical Isolates of Candida albicans and C. dubliniensis in Japan: Analysis Reveals a New Genotype of C. albicans with Group I Intron. Journal of clinical microbiology. 2001 Dec 1;39(12):4309-15.
13. Bii CC, Kangogo MC, Revathi G, Wanyoike MW. Genotypes of Candida albicans from clinical sources in Nairobi Kenya. African Journal of Microbiology Research. 2009 Sep 30;3(9):475-7.
14. Shivanand, D. and Saldanha, R. M.. Species identification of Candida isolates in various clinical specimens with their anti- fungal susceptibility patterns. Journal of Clinical and Diagnostic Research. 2011. 5: 1177 – 1181.
15. Haddadi P, Zareifar S, Badiee P, Alborzi A, Mokhtari M, Zomorodian K, Pakshir K, Jafarian H. Yeast colonization and drug susceptibility pattern in the pediatric patients with neutropenia. Jundishapur journal of microbiology. 2014 Sep;7(9).
16. Kourkoumpetis TK, Velmahos GC, Ziakas PD, Tampakakis E, Manolakaki D, Coleman JJ, Mylonakis E. The effect of cumulative length of hospital stay on the antifungal resistance of Candida strains isolated from critically ill surgical patients. Mycopathologia. 2011 Feb 1;171(2):85-91.
17. Pappas PG, Kauffman CA, Andes D, Benjamin Jr DK, Calandra TF, Edwards Jr JE, Filler SG, Fisher JF, Kullberg BJ, Ostrosky-Zeichner L, Reboli AC. Clinical practice guidelines for the management of candidiasis: 2009 update by the Infectious Diseases Society of America. Clinical infectious diseases. 2009 Mar 1:503-35.
18. Deorukhkar SC, Saini S. Laboratory approach for diagnosis of candidiasis through ages. International Journal of Current Microbiology and Applied Sciences. 2014;3(1):206-18.
19. Clemons KV, Feroze F, Holmberg K, Stevens DA. Comparative analysis of genetic variability among Candida albicans isolates from different geographic locales by three genotypic methods. Journal of Clinical Microbiology. 1997 Jun 1;35(6):1332-6.
20. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual Cold Spring Harbor. NY: Cold Spring Harbor Laboratory. 1982.
21. Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. American journal of clinical pathology. 1966 Apr 1;45(4_ts):493-6. CLSI2002
22. Samaka HM, Al-Mohana AM, Al-Hamadani AH, Al-Charrakh AH. Genotyping and antifungal susceptibility profile of Candida albicans isolated from cancer patients. J Chem Pharm Sci. 2018;11: 236-41.
23. Badiee P, Alborzi A, Joukar M. Molecular assay to detect nosocomial fungal infections in intensive care units. European journal of internal medicine. 2011 Dec 1;22(6):611-5.
24. Rizvi MM, El Hassadi IM, Younis SB. Bioefficacies of Cassia fistula: an Indian labrum. African journal of Pharmacy and Pharmacology. 2009 Jun 30;3(6):287-92.
25. Samaka, H.; Al Hamadani, A.H, and Almohana, A.M. Genotyping of Candida albicans isolated from Najaf hospitals. Lambert academic Publishing GmbH &Co., Saarbrucken, Germany: 2013: 100–234.
26. Satana D, Genc GE, Erturan Z. The antifungal susceptibilities of oral Candida spp isolates from HIV-infected patients. African Journal of Microbiology Research. 2010 Mar 18;4(6):466-70.
27. Mohammed NA. Detection of Candida spp. and other pathogens responsible for vulvovaginitis in women with contraceptive methods. College of Science/University of Baghdad. 2008.
28. Haider, T.K. Genotyping of Candida albicans isolated from broils by 25SrDNA analysis. Kufa journal for veterinary Medical Sciences. 2013.4(1):105-110.
29. Cartledge JD, Midgley J, Gazzard BG. Clinically significant azole cross-resistance in Candida isolates from HIV-positive patients with oral candidosis. Aids. 1997 Dec 11;11(15):1839-44.
Received on 05.04.2019 Modified on 21.05.2019
Accepted on 28.06.2019 © RJPT All right reserved
Research J. Pharm. and Tech. 2019; 12(11):5171-5176.
DOI: 10.5958/0974-360X.2019.00895.3