INTRODUCTION:
The genus Candida is responsible
for fungal infections in immunocompromised patients and hospitalized patients with
underlying disease1,2. Candida species usually colonize the skin
and mucous membranes of human and animals3,4. There are about 350 diverse
Candida species, but a few cause human diseases5.
Other non-albicans species were less likely found
in clinical samples although many reports described infections caused by these uncommon
Candida species6.
Isolation of Candida spp. from vaginal samples showed that
they can be presented in 20-50% of healthy women during their reproductive period,
but they showed a marked decrease after the menopause age7. C.albicans
normally inhabits in the vagina. It coexists with the beneficial bacteria such as
Lactobacillus spp. which interfere with the adherence of C.albicans to
vaginal epithelial cells8.
Clinical
symptoms of vulvovaginal candidiasis include itching, erythema and edema of the
vulva, white discharge from the vagina, and pain during sexual intercourse9.
Vaginal candidiasis can be diagnosed by routine techniques such as conventional
culture, and biochemical tests, but these are time-consuming and may not give accurate
results10.
Molecular
techniques such as (PCR) are more rapid and have high sensitivity and specificity
than conventional techniques11. Detection of C. albicans genotypes
is important in epidemiological studies.
In this method C. albicans was classified into five genotypes
according to the size of amplified PCR products: genotype A (450) bp, genotype B
(840) bp, genotype C (450 and 840) bp, genotype D (1,080) bp, and genotype E (1,400)
bp12,13. Studying Candida species and C.albicans genotypes
is important for correct treatment because there is a difference in response to
same antifungal treatment14,15.
It was founded that there was a
significant increase in the incidence of yeast infections in humans16.
The increase of infection rate by Candida species and the excessive using
of antifungal drugs have led to resistance to these drugs over the past few decades17.
Ultimately, this led to increasing in the morbidity and mortality14.
This study aimed to:
Determining of C.albicans
genotypes susceptibility to commonly used antifungal drugs.
MATERIALS
AND METHODS:
Culturing of collected samples:
Sabouraud dextrose agar (SDA) was used for primary isolation of
Candida species. It inhibits bacterial growth because of its low pH. For
enhance its selectivity; (0.005 g/L) of chloramphenicol vial was added to the media.
Vaginal samples that were collected by cotton swabs were streaked on the plates that contained the prepared media and incubated at 30ºC
for 48 hours for isolation pure Candida colonies. After the incubation period,
the isolates were examined for their shape, color, size, and consistency. The plates
were enclosed by parafilm to prevent contamination. Finally, they were stored in
the refrigerator to keep the culture18.
Identification of C.albicans
genotypes by PCR:
C.albicans isolates which were identified on CHROM agar media and formed germ
tubes; were selected to study their genotypes by PCR method.
Genomic DNA extraction:
Genomic DNAs were extracted
from C.albicans isolates according to the instructions of the provided kit,
and by using previously described methods by19.
Assessment of DNA concentration
and purity:
The concentration of extracted
DNA was estimated by using Nano drop; the device which was used for determining
the optical density (O.D) of DNA at 260nm and 280nm wave lengths. This device was
also used to measure the purity ratio of the extracted DNA according to the formula
below:
DNA purity = (O.D 260nm) / (O.D 280nm)
This ratio was used for detecting
if DNA was contaminated with protein preparation20.
PCR primers:
In order to identify Candida albicans genotypes
on the basis of 25S rDNA, two primers: CA-INT-L (ATAAGGGAAGTCGGCAAAATAGATCCGTAA)
and CA-INT-R (CCTTGGCTGTGGTTTCGCTAGATAGTAGAT) were used, and according to PCR products
sizes, C. albicans was classified into five genotypes: A, B, C, D, and E12;13.
PCR working solution:
Polymerase Chain Reaction (PCR) working solution which
was used for DNA amplification was prepared according to the protocol of the used
kit. 25μl of reaction mixture was prepared in each sterile Eppendorf tube as
follow: (working solution G2 green master mix PCR (12.5)µl, template DNA (5)µl,
forward primer (2.5)µl, revers primer (2.5)µl, grade water (2.5)µl, final volume
(25)µl.
Statistical Analysis:
Statistical analysis was conducted by using Statistical
Package for Social Sciences (SPSS) 16.01.
Antifungal sensitivity test for C.albicans genotypes:
Antifungal
susceptibility test refers to subjecting a specific drug to a fungi isolates and
observing its activity. In the current study; the isolates of C.albicans
genotypes were tested by the Kirby-Bauer disc diffusion technique on Mueller Hinton
agar plates 21.
The
antifungal agents that used are: Fluconazole, Ketoconazole, Miconazole and Nystatin
in concentration (25, 15, 10, 5) µg/disc respectively (Bioanalyse/Turkey) which
are usually used for treatment of VVC. Antifungal discs were placed on Mueller
Hinton agar surface by using sterile forceps. The plates were incubated at 35°C
for 24 h. The inhibition zone size was interpreted by referring to an interpretative
chart table (Table 1.) which is recommended by22 guidelines into sensitive,
intermediate and resistant.
Table
1.: Zone-diameter interpretive standers according to 22.
|
Antifungal agent
|
Disc content
|
Diameter of inhibition zones(mm)
|
|
Resistant
|
Intermediate
|
Sensitive
|
|
Fluconazole
|
25 μg
|
< 14
|
15 – 18 (DD)
|
> 19
|
|
Ketoconazole
|
15 μg
|
< 20
|
21 – 27(DD)
|
> 28
|
|
Miconazole
|
10 μg
|
<11
|
12 – 19 (DD)
|
> 20
|
|
Nystatin
|
50 μg
|
No zone
|
10 – 14 (DD)
|
> 15
|
Candida
albicans DNAs were extracted by using a Wizard® Genomic DNA
Purification Kit protocol. Nano drop apparatus was used in this study to measure the
absorbance of DNA solutions, DNA rehydration solution was used as a blank.
RESULTS:
The culture samples of vaginal swabs were firstly isolated
from sabouraud dextrose agar media then identified or diagnosed by culturing on
chrom agar media, the Candida albicans species were diagnosed as green color.
identification of C. albicans genotypes
by PCR targeting 25S rDNA, Measurement concentration and purity of the extracted
DNA from C.albicans isolates.
Concentrations of C.albicans DNAs were in range
of (15.9-60) ng/ml, and the purity (OD260/280 ratio) was in a range (1.7-1.9).
So the extracted DNAs were considered pure because they were within the expected
range of purity (1.7 -2) according to 23.
Genomic DNAs of all C. albicans isolates were amplified
by PCR to detect their genotypes using primer pairs (CA-INT-L and CA-INT-R) by targeting
the gene 25S rDNA. Gel electrophoresis profiles defined DNA products as following:
450 bp for C.albicans genotype A, 840 bp for genotype B, and both 450 bp
and 840 bp for genotype C (Figure 1: A & B). None of the PCR products in this
study were genotype D (1,080 bp) or genotype E (1,400 bp product).
Figure 1. A.: Agarose
gel electrophoresis of C. albicans genotypes by PCR targeting 25S rDNA on
2% Agarose gel, 5 volt/cm for
1 hr, stained with ethidium bromide dye. (part-
1). Genomic DNA products of 450 bp for genotype A in lanes: (61,31,44,21,13,1,5).
840 bp for genotype B in lanes: (20, 12). Both 450 bp and 840 bp for genotype C
in lanes: (52, 11). M indicates the lane containing 100 bp DNA ladder which is shown
on the left and right sides of the panels. NC refers to negative control.
Figure
1. B.: Agarose gel electrophoresis of C.
albicans genotypes by PCR targeting 25S rDNA on 2% Agarose gel, 5 volt/cm for
1 hr, stained with ethidium bromide dye (part
-2). Genomic DNA products of 450 bp for genotype A in lanes: (7, 14, 36, 41, 72,
84, 92). 840 bp for genotype B in lanes:
(2,
53). Both 450 bp and 840 bp for genotype C in lanes: (57). M indicates the lane
containing 100 bp DNA ladder which is shown on the left and right sides of the panels.
NC refers to negative control.
For the 21 isolates of C. albicans: 14 (66.7 %),
4 (19 %), and 3 (14.3%) isolates were recognized as genotypes A, B and C, respectively
(Table 1.).
Table
2.: Frequency of C.albicans genotypes in VVC patients
|
C. albicans genotypes
|
No.
|
%
|
|
A
|
14
|
66.7%
|
|
B
|
4
|
19%
|
|
C
|
3
|
`14.3%
|
|
Total
|
21
|
100%
|
These results showed that C.albicans genotype A
occupied the highest rate among all genotypes in a percentage of (66.7%), followed
by genotype B and C in the percentage of (19 %) and (14.3 %), respectively
.
Candida albicans genotypes were distributed in variable patterns in different groups. However,
genotype A was the most predominant type; 14 isolates of genotype A (66.7 %) were
detected through this study, its high rate of distribution was in contraception
users group (38.1%), while it was (33.3%) in patients group with vulval pruritus
symptom.
Genotype B followed genotype A in its frequency; its high
rate of distribution was in contraception users (19.1 %). and it was distributed
equally in (vulval pruritus & vaginal erythema groups) in a percentage of 9.5%.
Genotype C was found with a high rate in contraception
users (14.3%), followed by patients with vulval erythema and discharge (9. 5%).
Sensitivity of C.albicans genotypes to antifungal
drugs:
Figure
(1) shows the results of C.albicans genotypes sensitivity for the antifungal
drugs (Fluconazole, Ketoconazole, Miconazole, and Nystatin) by disc diffusion method.
The results of this test were interpreted according to22.
Figure
2: Susceptibility of C.albicans genotypes to antifungal drugs.
It
was showed that all C.albicans isolates (100 %) were sensitive to Miconazole;
in which the diameter of growth inhibition zone (> 20 mm), there was
no resistant to this drug. For Nystatin; 95.2 % of C.albicans isolates were
sensitive to it (growth inhibition zone diameters were > 15mm), while only 4.8
% were resistant (there was no inhibition zone on the medium).
In
the case of ketoconazole agent; 71.4% of isolates were sensitive (growth inhibition
zone diameters were > 28 mm), while 4.8% of isolates showed dose dependent sensitivity
(growth inhibition zone diameters were 21
– 27mm), and 23.8% were resistant (growth
inhibition zone diameters were < 20mm).
Finally,
for Fluconazole drug; 66.6% of isolates were sensitive (growth inhibition zone diameters
were > 19mm), while 4.8% were dose dependent (growth inhibition zone
diameters were 15 – 18mm), and 28.6% were resistant to this drug (growth inhibition
zone diameters were< 14mm), (Table 2.).
For
the 14 isolates of C.albicans genotype A; 64.3% of isolates were sensitive
to Fluconazole, while 7.1% and 28.6% of isolates were intermediate and resistant
to Fluconazole, respectively. In the case of Ketoconazole; 71.4% of isolates were
sensitive, 7.1% of isolates were intermediate, and 21.5% were resistant to Ketoconazole.
For Nystatin agent; 92.9% of isolates were sensitive, and only 7.1% of isolates
were resistant. Finally, all genotype A isolates were sensitive to Miconazole drug
in percentage of 100%, and there was no resistant to this drug (Figure 2.).
For
C.albicans genotype B; 75% of isolates were sensitive to Fluconazole, while
25% were resistant. In the case of Ketoconazole; also 75% of isolates were sensitive,
and 25 % of isolates were resistant to Ketoconazole. While for both Miconazole and
Nystatin; the sensitivity was 100 %, and there was no resistant to both drugs (Figure
3.).
Figure
3.: Susceptibility of C.albicans genotype A to antifungal drugs:
1- Resistance of isolates to Ketoconazole (Growth
inhibition zone diameter <20mm).
2- Resistance of isolates to Nystatin ( No inhibition
zone on the medium).
3- Sensitivity of isolates to Fluconazole (Growth
inhibition zone diameter > 19mm).
4- Sensitivity of isolates to Miconazole ( Growth
inhibition zone diameter > 20mm).
Figure
4.: Susceptibility of C.albicans genotype B to antifungals.
1- Sensitivity of isolates to Nystatin
(Growth inhibition zone diameter > 15 mm).
2- Resistance of isolates to Fluconzole
(Growth inhibition zone diameter <14mm).
3- Sensitivity of isolates to Miconazole
(Growth inhibition zone diameter > 20 mm).
4- Resistance of isolates to Ketoconazole
(Growth inhibition zone diameter <20mm).
Genotype
C isolates showed sensitivity for both Fluconazole and Ketoconazole drugs in a percentage
of 66.7 %, and resistance in a percentage of 33.3 %. In the case of Miconazole and
Nystatin; the sensitivity of the isolates was 100 %, and there was no resistant
to the both drugs (Figure 4.).
Figure
5.: Susceptibility of C.albicans genotype C to antifungals.
1- Sensitivity of isolates of Nystatin (Growth
inhibition zone diameter >15mm).
2- Resistance of isolates of Fluconazole( Growth
inhibition zone diameter <14mm).
3- Sensitivity of isolates of Miconazole (Growth
inhibition zone diameter>20 mm).
4- Resistance of isolates of Ketoconazole (Growth
inhibition zone diameter <20mm).
DISCUSSION:
The
antifungal drugs sensitivity test against C.albicans genotypes showed that all C.albicans isolates (100 %) were
sensitive to miconazole, and there was no resistant to this drug. For nystatin 95.2
% of C.albicans isolates were sensitive, while only 4.8 % were resistant.
In the case of ketoconazole agent; 71.4% of isolates were sensitive, while 4.8%
of isolates showed dose dependent sensitivity, and 23.8% were resistant. Finally,
for fluconazole drug; 66.6% of isolates were sensitive, while 4.8% were dose dependent,
and 28.6% were resistant to this drug (Figure 2).
The
isolates of C.albicans genotype A showed sensitivity in percentage of 100%
to miconazole, while its sensitivity to nystatin,
ketoconazole and fluconazole was 92.9%,71.4% and 64.3%, respectively. Genotype B
showed sensitivity in percentage of 100% to both nystatin and miconazole, while
they showed the same rate of sensitivity (75%) and resistance (25%) for both ketoconazole
and fluconazole drugs. Genotype C also showed the same sensitivity rate (100%) to
both nystatin and miconazole drugs, and showed sensitivity rate (66.7%) and resistance
rate (33.3%) for both ketoconazole and fluconazole drugs.as demonstrated in figure
(3,4,5) respectively.
There
was no significant association between C.albicans genotypes and antifungal
drugs (P>0.05). So these results agreed with those of23 who found
no significant association between C.albicans genotypes and antifungal drugs.
In
this study; the resistance of C.albicans genotypes (A, B and C) to fluconazole
agreed with23 in Iraq; who found that 15.2% of genotype A isolates were
resistant to fluconazole, and 25 % of both genotype B and C were resistant to this
drug.
Some
of the studies reported that reduced C.albicans susceptibilities to fluconazole
appeared after over usage of it as a treatment for some conditions; especially when
it was prescribed to the immunocompromised patients as a standard care, thus this
was the leading cause of resistance24 and25. The resistance
of the isolates for ketoconazole agreed with23 who found that the resistance
of genotype A, B, and C were (18.2%, 25%, and 25%) respectively. It also agreed
with the results of study by26 and24, but it disagreed with27
who found that there was no resistance to ketoconazole in isolates collected from
turkeys in Iraq.
The
results of genotypes sensitivity in a percentage of 100% for miconazole in the current
study agreed with28 and29 who didn’t find a resistance of
C.albicans isolates to miconazole in Iraq. Finally, the high sensitivity
of the isolates to nystatin agreed with the results obtained by30,28
who found a high sensitivity of these isolates to nystatin drug.
REFERENCES:
1.
Kumamoto CA, Pierce JV.
Immunosensing during colonization by Candida albicans: does it take a village
to colonize the intestine?. Trends in microbiology. 2011 Jun 1;19(6):263-7.
2.
Brenda, B.; James, A. and Benjamin,
D. K. Neonatal Candidiasis. Journal of Paediatrics, 2014. 79: 123- 125.
3.
Ruhnke M, Paiva J, Grigos I, Miller
P, Marcek T, Kantechi M. Anidulation for candidaemia in non-neutropenic
intensive care unit patients. Journal of Critical Care. 2011; 15:240.
4.
Udayalaxmi SJ, D’Souza D.
Comparison between virulence factors of Candida albicans and non-albicans
species of Candida isolated from genitourinary tract. Journal of clinical and
diagnostic research: JCDR. 2014 Nov;8(11):DC15.
5.
Williams DW, Kuriyama T, Silva S,
Malic S, Lewis MA. Candida biofilms and oral candidosis: treatment and
prevention. Periodontology 2000. 2011 Feb;55(1):250-65.
6.
Brandt ME, Lockhart SR. Recent
taxonomic developments with Candida and other opportunistic yeasts. Current
fungal infection reports. 2012 Sep 1;6(3):170-7.170-177.
7.
Ferreira C, Silva S, Faria-Oliveira
F, Pinho E, Henriques M, Lucas C. Candida albicans virulence and
drug-resistance requires the O-acyltransferase Gup1p. BMC microbiology. 2010
Dec;10(1):238.
8.
Gregory T. The quandary of
recurrent vaginal candidiasis. Patient Care. 2000 Jan 30;34(2):123-.
9.
Paulitsch A, Weger W, Ginter‐Hanselmayer G, Marth E, Buzina W. A 5‐year (2000–2004) epidemiological survey of Candida and
non‐Candida yeast species causing vulvovaginal candidiasis
in Graz, Austria. Mycoses. 2006 Nov;49(6):471-5.
10.
Hospenthal, D.R.; Beckius, M.L.;
Floyd, K.L.; Horvath, L.L. and Murray,C.K.. Presumptive identification of
Candida species other than C. albicans, C. krusei and C. tropicalis with
chromoagar medium Chromoagar candida. Ann. Clin. Microbiol. Antimicrob.
2006.5:1-5
11.
Goswami D, Goswami R, Banerjee U,
Dadhwal V, Miglani S, Lattif AA, Kochupillai N. Pattern of Candida species
isolated from patients with diabetes mellitus and vulvovaginal candidiasis and
their response to single dose oral fluconazole therapy. Journal of Infection.
2006 Feb 1;52(2):111-7.
12.
Tamura M, Watanabe K, Mikami Y,
Yazawa K, Nishimura K. Molecular Characterization of New Clinical Isolates of
Candida albicans and C. dubliniensis in Japan: Analysis Reveals a New Genotype
of C. albicans with Group I Intron. Journal of clinical microbiology. 2001 Dec
1;39(12):4309-15.
13.
Bii CC, Kangogo MC, Revathi G,
Wanyoike MW. Genotypes of Candida albicans from clinical sources in Nairobi
Kenya. African Journal of Microbiology Research. 2009 Sep 30;3(9):475-7.
14.
Shivanand, D. and Saldanha, R. M..
Species identification of Candida isolates in various clinical specimens with
their anti- fungal susceptibility patterns. Journal of Clinical and Diagnostic
Research. 2011. 5: 1177 – 1181.
15.
Haddadi P, Zareifar S, Badiee P,
Alborzi A, Mokhtari M, Zomorodian K, Pakshir K, Jafarian H. Yeast colonization
and drug susceptibility pattern in the pediatric patients with neutropenia.
Jundishapur journal of microbiology. 2014 Sep;7(9).
16.
Kourkoumpetis TK, Velmahos GC, Ziakas
PD, Tampakakis E, Manolakaki D, Coleman JJ, Mylonakis E. The effect of
cumulative length of hospital stay on the antifungal resistance of Candida
strains isolated from critically ill surgical patients. Mycopathologia. 2011
Feb 1;171(2):85-91.
17.
Pappas PG, Kauffman CA, Andes D,
Benjamin Jr DK, Calandra TF, Edwards Jr JE, Filler SG, Fisher JF, Kullberg BJ,
Ostrosky-Zeichner L, Reboli AC. Clinical practice guidelines for the management
of candidiasis: 2009 update by the Infectious Diseases Society of America.
Clinical infectious diseases. 2009 Mar 1:503-35.
18.
Deorukhkar SC, Saini S. Laboratory
approach for diagnosis of candidiasis through ages. International Journal of
Current Microbiology and Applied Sciences. 2014;3(1):206-18.
19.
Clemons KV, Feroze F, Holmberg K,
Stevens DA. Comparative analysis of genetic variability among Candida albicans
isolates from different geographic locales by three genotypic methods. Journal
of Clinical Microbiology. 1997 Jun 1;35(6):1332-6.
20.
Maniatis T, Fritsch EF, Sambrook J.
Molecular cloning: a laboratory manual Cold Spring Harbor. NY: Cold Spring
Harbor Laboratory. 1982.
21.
Bauer AW, Kirby WM, Sherris JC,
Turck M. Antibiotic susceptibility testing by a standardized single disk
method. American journal of clinical pathology. 1966 Apr 1;45(4_ts):493-6. CLSI2002
22.
Samaka HM, Al-Mohana AM,
Al-Hamadani AH, Al-Charrakh AH. Genotyping and antifungal susceptibility
profile of Candida albicans isolated from cancer patients. J Chem Pharm Sci.
2018;11: 236-41.
23.
Badiee P, Alborzi A, Joukar M.
Molecular assay to detect nosocomial fungal infections in intensive care units.
European journal of internal medicine. 2011 Dec 1;22(6):611-5.
24.
Rizvi MM, El Hassadi IM, Younis SB.
Bioefficacies of Cassia fistula: an Indian labrum. African journal of Pharmacy
and Pharmacology. 2009 Jun 30;3(6):287-92.
25.
Samaka, H.; Al Hamadani, A.H, and
Almohana, A.M. Genotyping of Candida albicans isolated from Najaf hospitals.
Lambert academic Publishing GmbH &Co., Saarbrucken, Germany: 2013: 100–234.
26.
Satana D, Genc GE, Erturan Z. The
antifungal susceptibilities of oral Candida spp isolates from HIV-infected
patients. African Journal of Microbiology Research. 2010 Mar 18;4(6):466-70.
27.
Mohammed NA. Detection of Candida
spp. and other pathogens responsible for vulvovaginitis in women with
contraceptive methods. College of Science/University of Baghdad. 2008.
28.
Haider, T.K. Genotyping of Candida
albicans isolated from broils by 25SrDNA analysis. Kufa journal for veterinary
Medical Sciences. 2013.4(1):105-110.
29.
Cartledge JD, Midgley J, Gazzard
BG. Clinically significant azole cross-resistance in Candida isolates from
HIV-positive patients with oral candidosis. Aids. 1997 Dec 11;11(15):1839-44.